Skip to main content

Table 2 Primer information

From: A comparative study on the regulatory region of the PERIOD1 gene among diurnal/nocturnal primates

Purposes of use Primer ID Primer names Species Region Length (bp) Sequences (5′ → 3′)
PCR & Sequencing #1 PER11stPRMF Primates Promoter 22 GCCCCCTCGCCTCCATTGACGG
  #2 PER11stINT1R Primates Intron1 24 GGGGGCAGGGAGAGGGTGGGTAGC
  #3 PER12ndPRMF Primates Promoter 23 GCTGGGCGGTGTCTGGGGCTCTT
  #4 PER12ndEX2R Primates Exon2 28 AACCATTGCTGTTGGCATCGGTGTCATC
  #5 GenPER1_1stPRM_R Primates Promoter 24 CTGAAGAGCCCCAGACACCGCCCA
Sequencing #6 PER1PRM_PW1 Primates Promoter 20 GGATCATTTTCAGGGAGAGG
  #7 PER1PRM_PW2 Primates Promoter 21 ATATGAAGCCCTTGCCATCCC
  #8 GenPER1_PRM_PW1 Primates Promoter 21 CGGCGGGCAGGCAGACGGAGG
  #9 PER1INT1_PW3 Primates Intron1 20 CAGAGGGCACACCGTCGTCC
  #10 GenPER1_INT1_PW2 Primates Intron1 21 GGCGCTAGTTCCTGCTGTTGG
  #11 GenPER11stPRM_PW1 Primates Promoter 21 CTATAATCCTAGCACTTTGGG
  #12 PER1PRM_PW5R Primates Promoter 20 GGTGTCTAGTACTTCCCTCC
  #13 GenPER1_PW3R Strepsirrhines Exon1 20 GTCCTCCGCACGCCTGCCCG
  #14 ShoPER1_PW1 Lesser galago Promoter 21 CCCTAGGCCGGCTGTGATGTC
  #15 PER1INT1_PW4 Primates Intron1 20 AGGGGCTAAAGAAGGAAAGG
  #16 GenPER1_PW4R Strepsirrhines Intron1 20 CCCACGCTCCTAGGACCCAG
  #17 OLPER1_PW1 Strepsirrhines Promoter 20 GACCAGCCTAAGCGAGACCC
  #18 ShoPER1_PW2 Strepsirrhines Promoter 21 GATGGAGGGGCTCTGTAACTG
  #19 LGPER1_PRM3 Strepsirrhines Promoter 22 TACTCACCCTCTAAACACGTGG
  #20 LemurPER1_PW1 Strepsirrhines Promoter 20 TGTCCCTCTGTAGTCCTAGC
  1. The column “species” means the group that has used its primer for PCR and sequencing (e.g., primer ID #13 cannot be used to sequence the upstream of haplorhines PER1 but can be used for that of strepsirrhines)