Skip to main content

Table 1 Primers used in this study

From: NOD-like receptors mediate inflammatory lung injury during plateau hypoxia exposure

Primer name Forward primer (5′–3′) Reverse primer (5′–3′)
β-actin GAAGATCAAGATCATTGCTCC TACTCCTGCTTGCTTGCGATCCA
IL-1 ATCCTCTCCAGTCAGGCTTCCTTGTG AGCTCTTGTCGAGATGCTGCTGTGA
IL-2 TGTTGCTGGACTTACAGGTGCTCCT CCACCACAGTTGCTGGCTCATCATC
IL-6 ACAGAGGATACCACCCACAACAGACC CGGAACTCCAGAAGACCAGAGCAGAT
IL-18 TGCCTGATATCGACCGAACAGCCAAC ACAGATAGGGTCACAGCCAGTCCTCT
NOD1 CTCAAAGGAGGACCTGCTGCTGGA GAAGACAGTCTCGCCATGCTCGTTGA
NOD2 GGCAGCACAGGTGGACTCTGAGGATA GCAGCAGCCTTAGCAGCAGTGAGTT
TNT-α CCAGCAGGAGGGAGAACAGCAACT CCGCCACGAGCAGGAATGAGAAGAG