Table 1 The sequences of the primers used for tetraprimer amplification refractory mutation system polymerase chain reaction (T-ARMS-PCR)
Gene | Primer sequence | Product size | Annealing temp. °C |
|---|---|---|---|
FTO | Forward outer primer: AGTTCCAGTCATTTTTGACAGC Reverse outer primer: AGCCTCTCTACCATCTTATGTC Forward inner primer: CCTTGCGACTGCTGTGAATATA Reverse inner primer: GAGACTATCCAAGTGCATCTCA | Control fragment: 429bp T allele: 278bp A allele: 194bp | 59.50 |